Laribacter hongkongensis: LHK_03220 Help Entry LHK_03220         CDS       T00884                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism lhk  Laribacter hongkongensis Brite KEGG Orthology (KO) [BR:lhk00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:lhk03036]     LHK_03220 Chromosome and associated proteins [BR:lhk03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LHK_03220 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB SKA2 DUF4250 ACBP4_C DMPK_coil DUF3450 CENP-F_leu_zip DUF7615 Allexi_40kDa ADIP WipA_N T3SS_needle_E USHBP1_PDZ-bd Motif Other DBs NCBI-ProteinID:  ACO76198 UniProt:  C1D6G3 LinkDB All DBs Position complement(3123957..3124160) Genome browser AA seq 67 aa AA seqDB search MINAELERLHATVQTLADLCERLAADKRELATRLAESEAHNAALTTRLDMTRTRIESLIA RLPEVKE NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atgataaatgccgaactcgaacgtctgcatgccacggtgcagacccttgccgatctgtgc gagcgcctcgcggcggacaagcgtgagctggcgacccggctggccgagtccgaagcgcac aatgccgcgctgacgacccgtcttgacatgacgcgcacgcggatcgagagcctgattgcc cgtctgccggaggtgaaagaatga

DBGET integrated database retrieval system