Lysinibacillus irui: OU989_04565 Help Entry OU989_04565       CDS       T09550                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism liu  Lysinibacillus irui Pathway liu01100   Metabolic pathways liu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:liu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     OU989_04565 (acpP)    00074 Mycolic acid biosynthesis     OU989_04565 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     OU989_04565 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  WDV07764 UniProt:  A0AAJ5UU83 LinkDB All DBs Position 970010..970246 Genome browser AA seq 78 aa AA seqDB search MSTVLERVTKVIVDRLGVEESEVTLEASFRDDLGADSLDVVELVMELEDEFDMEISDEDA EKISTVGSAISYIESKIG NT seq 237 nt NT seq  +upstreamnt  +downstreamnt ttgtctacagtattagaacgtgtaacaaaagtaatcgtggaccgtttaggtgttgaagaa agcgaagtaacacttgaagcttctttccgtgatgatttaggtgctgactcattagacgta gttgagcttgtaatggagcttgaagacgaattcgatatggaaatttctgatgaagatgct gaaaaaatctcaacagtaggttctgcaatttcatacatcgaaagtaaaattggctaa

DBGET integrated database retrieval system