Legionella longbeachae: LLO_2612 Help Entry LLO_2612          CDS       T01183                                  Name (GenBank) putative acyl-carrier protein   KO K02078   acyl carrier protein Organism llo  Legionella longbeachae Pathway llo00998   Biosynthesis of various antibiotics llo01100   Metabolic pathways llo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:llo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LLO_2612    00074 Mycolic acid biosynthesis     LLO_2612   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LLO_2612 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 SEEK1 Motif Other DBs NCBI-ProteinID:  CBJ13038 Pasteur:  llo2612 UniProt:  D3HKS2 LinkDB All DBs Position complement(3065064..3065291) Genome browser AA seq 75 aa AA seqDB search MKITESELKNIIAKLSGCKAEEIHHGTALIEDLHLDSLKIVELLAILSEEYNLAVTEDDA MNFHTFKDIFDFTQA NT seq 228 nt NT seq  +upstreamnt  +downstreamnt atgaaaattactgagagtgaattaaagaatattattgccaagttatctggttgtaaggcg gaggaaattcatcatggaaccgctttaatagaggacctacatttagattctttaaagatt gtagaactacttgccattctcagtgaagaatataatttagcagtgaccgaagatgatgcg atgaatttccatacttttaaggatatatttgattttactcaagcttaa

DBGET integrated database retrieval system