Listeria marthii: LAX80_008870 Help Entry LAX80_008870      CDS       T07828                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism lmar  Listeria marthii Pathway lmar01100   Metabolic pathways lmar01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:lmar00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LAX80_008870    00074 Mycolic acid biosynthesis     LAX80_008870   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LAX80_008870 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 DUF1493 Ribosomal_L12_N Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  UHP09286 LinkDB All DBs Position complement(1781978..1782211) Genome browser AA seq 77 aa AA seqDB search MAEVLEKVTKIIVDRLGVEESKVTLEASFKEDLGADSLDVVELVMELEDEFGVEISDGDA ENINTVGDAVKYIEANA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagaagtattagaaaaagttacaaaaatcatcgtagaccgtttaggtgtcgaggaa tccaaagtaactttagaagcttccttcaaagaagatctaggtgctgattccctagatgtt gttgaattagtaatggaacttgaagacgagttcggagttgaaatctctgatggcgacgct gaaaacattaacacagttggtgatgcagtgaagtacatagaggcaaacgcataa

DBGET integrated database retrieval system