Marilutibacter maris: C9I47_2738 Help Entry C9I47_2738        CDS       T05495                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism lmb  Marilutibacter maris Brite KEGG Orthology (KO) [BR:lmb00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:lmb03036]     C9I47_2738 Chromosome and associated proteins [BR:lmb03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     C9I47_2738 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB GAS bZIP_1 Herpes_BLRF2 bZIP_2 Taxilin YabA DUF7491 Angiomotin_C APG6_N COG3_N DUF7603 Tropomyosin Stathmin DUF7620 Uso1_p115_C Nup88 APH TMF_DNA_bd FTA4 DUF2203 DUF2721 Motif Other DBs NCBI-ProteinID:  AWV08414 UniProt:  A0A2U9TC30 LinkDB All DBs Position 3379913..3380134 Genome browser AA seq 73 aa AA seqDB search MDHAELLAQLQALAARVEQLADRARRLGEENRSLRQQQEQLVGERSALLAKNEQARVRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggatcacgccgaactgctcgcgcaactgcaagccctggccgcccgcgtcgagcagctg gccgatcgcgcgcgccggctcggcgaggagaaccgcagtctgcggcagcaacaggaacag ctcgtcggcgagcgttccgcgctgctggccaagaacgagcaggcccgggtccgggtcgaa gccatgatcgcgcgcctgaagtcgctggagcagcacacgtga

DBGET integrated database retrieval system