Lytechinus pictus (painted urchin): 129272888 Help Entry 129272888         CDS       T09066                                  Name (RefSeq) serum amyloid A protein-like   KO K17310   serum amyloid A protein Organism lpic  Lytechinus pictus (painted urchin) Brite KEGG Orthology (KO) [BR:lpic00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:lpic04147]     129272888 Exosome [BR:lpic04147]  Exosomal proteins   Exosomal proteins of other cancer cells    129272888 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  SAA Motif Other DBs NCBI-GeneID:  129272888 NCBI-ProteinID:  XP_054765947 LinkDB All DBs Position 12:9273932..9275729 Genome browser AA seq 82 aa AA seqDB search MREANWRNSDKYFHARGNYDAAQRGPGGAWAAGVISNARESYQSGLSGQGPEDTAADQAA NHWGRNGGDPNVYRPAGLPEQY NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgcgtgaagccaactggaggaattcagacaagtactttcatgcacgaggcaactacgat gccgcacagcgaggacccggaggagcttgggcagctggcgtcattagcaacgcacgcgaa agttatcaatctggcctcagcggtcaaggacccgaggatactgcagctgaccaggcggct aaccactgggggcgcaacggtggagaccccaacgtatatcgaccagcaggactccctgag caatactaa

DBGET integrated database retrieval system