Labeo rohita (rohu): 127168170 Help Entry 127168170         CDS       T09007                                  Symbol mtbl Name (RefSeq) metallothionein-B-like   KO K14739   metallothionein 1/2 Organism lroh  Labeo rohita (rohu) Brite KEGG Orthology (KO) [BR:lroh00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:lroh03019]     127168170 (mtbl)    03029 Mitochondrial biogenesis [BR:lroh03029]     127168170 (mtbl) Messenger RNA biogenesis [BR:lroh03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      127168170 (mtbl) Mitochondrial biogenesis [BR:lroh03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     127168170 (mtbl) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  127168170 NCBI-ProteinID:  XP_050970722 LinkDB All DBs Position 7:complement(32877338..32878340) Genome browser AA seq 63 aa AA seqDB search MDPCGCSKSGSCDCGQNCKCTDCKCAPSKKSCGSCPSEGSKDKKGCESACKDKEKSCETR CCK NT seq 192 nt NT seq  +upstreamnt  +downstreamnt atggatccgtgtggctgctctaaatctggatcttgtgactgcgggcaaaactgcaaatgc accgactgcaagtgcgcacctagcaagaaaagttgcggcagttgtccatctgaaggcagt aaggacaagaagggctgcgagagcgcctgcaaggacaaggagaagtcgtgcgagacacgc tgctgcaaataa

DBGET integrated database retrieval system