Lysinibacillus sphaericus: Bsph_1520 Help Entry Bsph_1520         CDS       T00656                                  Name (GenBank) Acyl carrier protein (ACP)   KO K02078   acyl carrier protein Organism lsp  Lysinibacillus sphaericus Pathway lsp01100   Metabolic pathways lsp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:lsp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Bsph_1520    00074 Mycolic acid biosynthesis     Bsph_1520   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Bsph_1520 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  ACA39120 UniProt:  B1HQH3 LinkDB All DBs Position 1612537..1612782 Genome browser AA seq 81 aa AA seqDB search MNHLSTVLERVTKVIVDRLGVEESEVTLEASFRDDLGADSLDVVELVMELEDEFDMEISD EDAEKISTVGSAISYIESKIN NT seq 246 nt NT seq  +upstreamnt  +downstreamnt gtgaatcatttgtctacagtattagaacgcgtaacaaaagtaatcgtggaccgtttaggt gttgaagaaagcgaagtaacacttgaagcttctttccgtgatgatttaggtgctgactca ttagacgtagttgagcttgtaatggagcttgaagacgaattcgatatggaaatttctgat gaagatgctgaaaaaatctcaacagtaggttctgcaatttcatacatcgaaagtaaaata aactaa

DBGET integrated database retrieval system