Agrilutibacter terrestris: H8B22_04630 Help Entry H8B22_04630       CDS       T07218                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism lsx  Agrilutibacter terrestris Brite KEGG Orthology (KO) [BR:lsx00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:lsx03036]     H8B22_04630 Chromosome and associated proteins [BR:lsx03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     H8B22_04630 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  CCDC122 ZapB DUF7491 T4SS_LegC2C7 SPC25_N COG3_N APG6_N TSC22 YabA ADIP CC_Bre1 KIF21A_2nd Motif Other DBs NCBI-ProteinID:  QNP41507 UniProt:  A0A7H0FZP1 LinkDB All DBs Position 993731..993952 Genome browser AA seq 73 aa AA seqDB search MDRTRLIAELQTLSDRLDELGAQARRLNEENRSLRLQQEQLISERSTLLAKNEQARTRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggatcgcacccgcctcatcgccgaactgcagacgctgtcggatcgcctcgacgagctg ggtgcgcaggcacgccgcctcaacgaagagaaccgcagcctgcgcctgcagcaggaacag ttgatcagcgagcgctcgactttgctggcgaagaacgaacaggcgcgcacgcgggtggag gcgatgatcgcccgcctcaagtcgctggagcagcacacgtga

DBGET integrated database retrieval system