Yoonia vestfoldensis: LOKVESSMR4R_02566 Help Entry LOKVESSMR4R_02566 CDS       T04854                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism lvs  Yoonia vestfoldensis Pathway lvs01100   Metabolic pathways lvs01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:lvs00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LOKVESSMR4R_02566 (acpP)    00074 Mycolic acid biosynthesis     LOKVESSMR4R_02566 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LOKVESSMR4R_02566 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 Motif Other DBs NCBI-ProteinID:  ARU01868 UniProt:  A0A1Y0EEK2 LinkDB All DBs Position complement(2552075..2552281) Genome browser AA seq 68 aa AA seqDB search MSDTAKRVRKVIAAKFNMDEADLVSEASFVADLGADSLDIVEISMAIEKEFGIEILMTTS RAPKRLAI NT seq 207 nt NT seq  +upstreamnt  +downstreamnt atgagcgacacagcaaagcgcgtcagaaaagtcattgccgcaaagtttaacatggatgaa gccgaccttgtgtctgaggcatcgttcgtcgccgacctcggcgctgacagtctggatatc gtcgaaatctccatggccatcgaaaaagagttcggtatcgagattttgatgacgacatcg agagcaccaaaacgcttggcgatctag

DBGET integrated database retrieval system