Leptonychotes weddellii (Weddell seal): 102736329 Help Entry 102736329         CDS       T08708                                  Name (RefSeq) metallothionein-2-like   KO K14739   metallothionein 1/2 Organism lww  Leptonychotes weddellii (Weddell seal) Pathway lww04978   Mineral absorption Brite KEGG Orthology (KO) [BR:lww00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     102736329  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:lww03019]     102736329    03029 Mitochondrial biogenesis [BR:lww03029]     102736329 Messenger RNA biogenesis [BR:lww03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      102736329 Mitochondrial biogenesis [BR:lww03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     102736329 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  102736329 NCBI-ProteinID:  XP_006749275 UniProt:  A0A2U3YZV4 LinkDB All DBs Position Unknown AA seq 61 aa AA seqDB search MDPNCSCTPGGSCTCAGSCKCKECRCTSCKKSCCSCCPAGCAKCAQGCICKGASDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatcccaactgctcctgcacccccggtggctcctgcacgtgcgccggctcctgcaaa tgcaaagagtgcagatgcacctcctgcaagaagagctgctgctcctgctgtcccgcgggc tgtgccaagtgcgcccagggctgcatctgcaaaggcgcgtcggacaagtgcagctgctgt gcctga

DBGET integrated database retrieval system