Lysinibacillus sp. PLM2: MTP04_12370 Help Entry MTP04_12370       CDS       T09546                                  Symbol acpA Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism lyp  Lysinibacillus sp. PLM2 Pathway lyp01100   Metabolic pathways lyp01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:lyp00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MTP04_12370 (acpA)    00074 Mycolic acid biosynthesis     MTP04_12370 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MTP04_12370 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc DUF1896 Motif Other DBs NCBI-ProteinID:  BDH61107 LinkDB All DBs Position 1289978..1290214 Genome browser AA seq 78 aa AA seqDB search MATVLERVTKVIVDRLGVDESEVKAEASFREDLGADSLDVVELVMELEDEFDMEISDEDA EKIATVGDAINYIEGKLN NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggctacagtattagaacgtgtaacaaaagtaatcgttgaccgtttaggtgttgacgaa agtgaagtaaaagcagaagcttctttccgtgaagatttaggtgcggactcattagacgtt gttgaattagtaatggaacttgaagatgaatttgatatggaaatttcagatgaagatgct gaaaaaatcgcaactgttggcgatgctatcaattatattgaaggtaaactaaactaa

DBGET integrated database retrieval system