Methylobacterium aquaticum: Maq22A_c16170 Help Entry Maq22A_c16170     CDS       T04311                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism maqu  Methylobacterium aquaticum Pathway maqu00998   Biosynthesis of various antibiotics maqu01100   Metabolic pathways maqu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:maqu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Maq22A_c16170    00074 Mycolic acid biosynthesis     Maq22A_c16170   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Maq22A_c16170 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  BAQ46372 UniProt:  A0A0C6FH68 LinkDB All DBs Position 3096931..3097173 Genome browser AA seq 80 aa AA seqDB search MTEDAALAALAPLFEDVFGEPVPLSPGLTAEDVEGWDSTRMIELVIAVEARFGIKLTTRE VDGLGSVGDLAAVIARKAPR NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgaccgaagacgccgcgctcgcagccctcgccccgctcttcgaagacgtgttcggcgag ccggtgccgctcagccccgggctcaccgccgaggacgtcgagggctgggactcgacccgg atgatcgagctcgtcatcgcggtcgaggcgcgcttcggcatcaagctcaccacccgggag gtcgacgggctgggaagcgtcggcgacctcgcggcggtgatcgcccgcaaggcgccgcgg tga

DBGET integrated database retrieval system