Micromonospora cathayae: PVK37_23595 Help Entry PVK37_23595       CDS       T10286                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mcay  Micromonospora cathayae Pathway mcay00998   Biosynthesis of various antibiotics mcay01100   Metabolic pathways mcay01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mcay00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PVK37_23595    00074 Mycolic acid biosynthesis     PVK37_23595   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PVK37_23595 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  WDZ83423 UniProt:  A0ABY7ZMX1 LinkDB All DBs Position complement(5266854..5267120) Genome browser AA seq 88 aa AA seqDB search MTVTAHDTANAQIVSAIVVALEEVLGQELTDVTEQTRLFDDLSLDSTSVLGLLMALEDAL DMQVDPEGLEQSHLETVGSLAAFIAESR NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atgaccgtcaccgcccacgacaccgccaacgcccagatcgtctccgccatcgtcgtcgcc ctcgaggaggtgctcggccaggaactgaccgacgtcaccgagcagacccgcctcttcgac gacctcagcctggactccaccagcgtgctcggcctgctgatggccctggaggacgccctg gacatgcaggtcgacccggagggcctggagcagtcccacctggagacggtcggctcgctg gccgccttcatcgccgagagccgctga

DBGET integrated database retrieval system