Macaca mulatta (rhesus monkey): 100315140 Help Entry 100315140         miRNA     T01028                                  Symbol MIR214 Name (RefSeq) mml-miR-214-5p   KO K17151   microRNA 214 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315140 (MIR214)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315140 (MIR214)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315140 (MIR214) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    100315140 (MIR214)   Exosomal RNA of lung cancer cells    100315140 (MIR214) Non-coding RNAs [BR:mcc03100]  Other eukaryotic RNA   Micro RNA    100315140 (MIR214) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315140 Ensembl:  ENSMMUG00000026913 miRBase:  MI0002858 LinkDB All DBs Position 1:complement(29439872..29439981) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tgcctgtctacacttgctgtgc

DBGET integrated database retrieval system