Macaca mulatta (rhesus monkey): 100315182 Help Entry 100315182         miRNA     T01028                                  Symbol MIR29B-1 Name (RefSeq) mml-miR-29b-1-5p   KO K16996   microRNA 29b Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer mcc05207   Chemical carcinogenesis - receptor activation Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315182 (MIR29B-1)    05207 Chemical carcinogenesis - receptor activation     100315182 (MIR29B-1)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315182 (MIR29B-1)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315182 (MIR29B-1) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315182 (MIR29B-1)   Exosomal RNA of saliva    100315182 (MIR29B-1) Non-coding RNAs [BR:mcc03100]  Small non-coding RNA   Micro RNA    100315182 (MIR29B-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315182 Ensembl:  ENSMMUG00000027128 miRBase:  MI0007596 LinkDB All DBs Position 3:complement(157198060..157198140) Genome browser NT seq 25 nt NT seq  +upstreamnt  +downstreamnt agctggtttcatatggtggtttaga

DBGET integrated database retrieval system