Macaca mulatta (rhesus monkey): 100315385 Help Entry 100315385         miRNA     T01028                                  Symbol MIR20A Name (RefSeq) mml-miR-20a-5p   KO K17006   microRNA 20 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315385 (MIR20A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315385 (MIR20A)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315385 (MIR20A) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315385 (MIR20A)   Exosomal RNA of other cancer cells    100315385 (MIR20A) Non-coding RNAs [BR:mcc03100]  Other eukaryotic RNA   Micro RNA    100315385 (MIR20A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315385 Ensembl:  ENSMMUG00000027060 miRBase:  MI0003004 LinkDB All DBs Position 17:73152573..73152643 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt taaagtgcttatagtgcaggta

DBGET integrated database retrieval system