Macaca mulatta (rhesus monkey): 100315508 Help Entry 100315508         miRNA     T01028                                  Symbol MIR92A-2 Name (RefSeq) mml-miR-92a-5p   KO K17008   microRNA 92a Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315508 (MIR92A-2)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315508 (MIR92A-2)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315508 (MIR92A-2) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315508 (MIR92A-2)   Exosomal RNA of colorectal cancer cells    100315508 (MIR92A-2)   Exosomal RNA of renal carcinoma cells    100315508 (MIR92A-2)   Exosomal RNA of other cancer cells    100315508 (MIR92A-2) Non-coding RNAs [BR:mcc03100]  Small non-coding RNA   Micro RNA    100315508 (MIR92A-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315508 Ensembl:  ENSMMUG00000027125 miRBase:  MI0007606 LinkDB All DBs Position X:complement(130425227..130425301) Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt gggtggggatttgttgcattact

DBGET integrated database retrieval system