Macaca mulatta (rhesus monkey): 100315516 Help Entry 100315516         miRNA     T01028                                  Symbol MIR184 Name (RefSeq) mml-miR-184   KO K17177   microRNA 184 Organism mcc  Macaca mulatta (rhesus monkey) Brite KEGG Orthology (KO) [BR:mcc00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315516 (MIR184)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315516 (MIR184) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of renal carcinoma cells    100315516 (MIR184)   Exosomal RNA of other cancer cells    100315516 (MIR184) Non-coding RNAs [BR:mcc03100]  Other eukaryotic RNA   Micro RNA    100315516 (MIR184) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315516 Ensembl:  ENSMMUG00000026851 miRBase:  MI0007648 LinkDB All DBs Position 7:56515401..56515484 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tggacggagaactgataagggt

DBGET integrated database retrieval system