Macaca mulatta (rhesus monkey): 100315526 Help Entry 100315526         miRNA     T01028                                  Symbol MIR342 Name (RefSeq) mml-miR-342-5p   KO K17132   microRNA 342 Organism mcc  Macaca mulatta (rhesus monkey) Pathway mcc05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:mcc00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315526 (MIR342)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mcc04147]     100315526 (MIR342)   09184 RNA family    03100 Non-coding RNAs [BR:mcc03100]     100315526 (MIR342) Exosome [BR:mcc04147]  Exosomal RNA   Exosomal RNA of breast milk    100315526 (MIR342)   Exosomal RNA of hepatic cancer cells    100315526 (MIR342) Non-coding RNAs [BR:mcc03100]  Small non-coding RNA   Micro RNA    100315526 (MIR342) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315526 Ensembl:  ENSMMUG00000027106 miRBase:  MI0007704 LinkDB All DBs Position 7:162324299..162324397 Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt aggggtgctatctgtgattga

DBGET integrated database retrieval system