Methylorubrum extorquens CM4: Mchl_3032 Help Entry Mchl_3032         CDS       T00809                                  Name (GenBank) conserved hypothetical protein   KO K02078   acyl carrier protein Organism mch  Methylorubrum extorquens CM4 Pathway mch01100   Metabolic pathways mch01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mch00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mchl_3032   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mchl_3032 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  ACK83870 UniProt:  B7KRD4 LinkDB All DBs Position 3200457..3200690 Genome browser AA seq 77 aa AA seqDB search MSGFYEELAEILEVEPDQVTADLRLESTSWDSLAVVSTIALIDEQYDKAVNATALAACET VGDIERLIAARSTESEA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagcggcttttacgaagaactcgcggagatcctcgaggtcgagccggaccaagtcacc gccgacctacgattggagagcacgtcgtgggactcgctggctgtggtctccaccattgcc ctgatcgatgagcagtatgacaaggcggtcaacgccacggccctcgctgcgtgcgagacg gtcggcgacatcgagcgcttgattgccgcgcgctcgaccgagagcgaggcgtag

DBGET integrated database retrieval system