Methylorubrum extorquens CM4: Mchl_3736 Help Entry Mchl_3736         CDS       T00809                                  Name (GenBank) conserved hypothetical protein   KO K02078   acyl carrier protein Organism mch  Methylorubrum extorquens CM4 Pathway mch01100   Metabolic pathways mch01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mch00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mchl_3736    00074 Mycolic acid biosynthesis     Mchl_3736   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mchl_3736 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ACK84555 UniProt:  B7KX30 LinkDB All DBs Position complement(3946305..3946556) Genome browser AA seq 83 aa AA seqDB search MADVREAIFAFIAARNPGLPSGAVTGETSLVTSDALDSIGILDLMMHLGDRFGVEVDEDS FDLANFASVDTLAHFIDDRRSDV NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atggccgacgtgcgggaggcgatcttcgccttcatcgcggcccgcaacccgggccttccc tccggcgccgtcaccggggagacttccctcgtgaccagcgacgcgctcgattcgatcggc atcctcgacctgatgatgcatctcggcgaccgcttcggcgtcgaggtcgacgaggacagc ttcgacctcgcgaacttcgccagcgtcgacacgctggcccatttcatcgacgaccggcgt tccgacgtctga

DBGET integrated database retrieval system