Methylorubrum extorquens DM4: METDI1610 Help Entry METDI1610         CDS       T00947                                  Name (GenBank) hypothetical protein   KO K18997   chaperone modulatory protein CbpM Organism mdi  Methylorubrum extorquens DM4 Brite KEGG Orthology (KO) [BR:mdi00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:mdi03036]     METDI1610 Chromosome and associated proteins [BR:mdi03036]  Prokaryotic type   Nucleoid associated proteins    Other nucleoid associated proteins     METDI1610 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  MerR_2 Motif Other DBs NCBI-ProteinID:  CAX23206 UniProt:  C7CGV6 LinkDB All DBs Position complement(1476436..1476639) Genome browser AA seq 67 aa AA seqDB search MLDDTGSSSASLSEIDLARGQLIRHLGDEFGVNAEGIGIILDLLDQVHGLRSVLREVLQS SAAREER NT seq 204 nt NT seq  +upstreamnt  +downstreamnt ttgctggatgacaccgggtcgtccagtgcgagcctgtcggagatcgacctggcgcgaggg cagctgatccggcacctcggcgacgagttcggagtcaacgcagagggaatcgggatcatt ctcgatctcctcgatcaggtgcacggacttcgatccgtgctccgggaagtgctgcagagc tctgctgccagggaggaacgctga

DBGET integrated database retrieval system