Methylorubrum extorquens AM1: Mex_1p3005 Help Entry Mex_1p3005        CDS       T00921                                  Name (GenBank) putative acyl carrier protein   KO K02078   acyl carrier protein Organism mea  Methylorubrum extorquens AM1 Pathway mea01100   Metabolic pathways mea01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mea00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mex_1p3005    00074 Mycolic acid biosynthesis     Mex_1p3005   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mex_1p3005 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Motif Other DBs NCBI-ProteinID:  ACS40753 UniProt:  C5AVR7 LinkDB All DBs Position 3139111..3139344 Genome browser AA seq 77 aa AA seqDB search MSGFYEELAEILEVEPDQVTADLRLESTSWDSLAVVSTIALIDEQYDKAVNATALAACET VGDIERLIAARQTESEA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagcggcttttacgaagaactcgcggagatcctggaggtcgagccggaccaagtcacg gccgacctacgcttggagagcacgtcgtgggactcgctggccgtggtctccaccattgcc ctgatcgatgagcagtatgacaaggcggtcaacgccacggccctcgctgcgtgcgagacg gtcggcgatatcgagcgcttgattgcagcacgccagaccgagagcgaggcgtaa

DBGET integrated database retrieval system