Metabacillus endolithicus: MVE64_23425 Help Entry MVE64_23425       CDS       T09915                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism menl  Metabacillus endolithicus Pathway menl01100   Metabolic pathways menl01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:menl00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MVE64_23425 (acpP)    00074 Mycolic acid biosynthesis     MVE64_23425 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MVE64_23425 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Guanylate_cyc DUF1493 Motif Other DBs NCBI-ProteinID:  UPG63234 LinkDB All DBs Position 4620319..4620552 Genome browser AA seq 77 aa AA seqDB search MADVLERVTKIIVDRLGVDEAEVKLESSFKDDLGADSLDVVELVMELEDEFDMEISDEDA EKIGTVGDAVNYINSQQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatgtattagaacgtgtaacaaagatcatcgttgaccgcttaggcgttgatgaa gctgaggtaaaattagagtcttcttttaaagatgatcttggagcagattcccttgatgta gttgagcttgttatggaacttgaagatgagttcgatatggaaatttctgatgaagatgca gaaaaaatcggtacagtgggtgacgctgttaactacataaatagccaacagtaa

DBGET integrated database retrieval system