Methanothermobacter sp. EMTCatA1: tca_00234 Help Entry tca_00234         CDS       T05328                                  Name (GenBank) hypothetical protein   KO K24450   DNA-binding protein Organism mete  Methanothermobacter sp. EMTCatA1 Brite KEGG Orthology (KO) [BR:mete00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:mete03036]     tca_00234 Chromosome and associated proteins [BR:mete03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     tca_00234 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CBFD_NFYB_HMF Histone TAF CENP-T_C CENP-S TFIID_20kDa Bromo_TP TFIID-31kDa DUF1931 Motif Other DBs NCBI-ProteinID:  BAZ98309 UniProt:  A0A223ZDV6 LinkDB All DBs Position 196605..196808 Genome browser AA seq 67 aa AA seqDB search MELPIAPIGRIIKNAGAERVSDDAREALAKVLEAKGEEIAENAVKLAKHAGRKTVKASDI ELAVKRM NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atggaattgccaatagctccaattggaagaataataaagaatgccggtgcagaaagagta agtgatgatgcaagggaagcccttgcaaaggtccttgaagcaaaaggtgaagaaatagct gaaaacgctgttaaacttgcaaaacacgctggaaggaagacggttaaagcctcagacatt gaactggcagttaaaaggatgtaa

DBGET integrated database retrieval system