Methylorubrum sp. GM97: MSPGM_27610 Help Entry MSPGM_27610       CDS       T10720                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism metq  Methylorubrum sp. GM97 Pathway metq01100   Metabolic pathways metq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:metq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MSPGM_27610    00074 Mycolic acid biosynthesis     MSPGM_27610   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MSPGM_27610 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Motif Other DBs NCBI-ProteinID:  BDL40171 LinkDB All DBs Position 3039756..3039989 Genome browser AA seq 77 aa AA seqDB search MSGFYEELAEILEVEPDQVTADLRLESTSWDSLAVVSTIALIDEQYDKAVNATALAACET VGDIERLIAARQTESEA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagcggcttttacgaagaactcgcggagatcctggaggtcgagccggaccaagtcacg gccgacctacgcttggagagcacgtcgtgggactcgctggccgtggtctccaccattgcc ctgatcgatgagcagtatgacaaggcggtcaacgccacggccctcgctgcgtgcgagacg gtcggcgatatcgagcgcttgattgcagcacgccagaccgagagcgaggcgtaa

DBGET integrated database retrieval system