Methylorubrum extorquens PA1: Mext_2804 Help Entry Mext_2804         CDS       T00640                                  Name (GenBank) conserved hypothetical protein   KO K02078   acyl carrier protein Organism mex  Methylorubrum extorquens PA1 Pathway mex01100   Metabolic pathways mex01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mex00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mext_2804    00074 Mycolic acid biosynthesis     Mext_2804   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mext_2804 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C PP-binding_2 Motif Other DBs NCBI-ProteinID:  ABY31195 LinkDB All DBs Position 3140768..3141001 Genome browser AA seq 77 aa AA seqDB search MSGFYEELAEILEVEPNQVTADLRLESTSWDSLAVVSTIALIDEQYDKAVNATALAACET VGDIERLIAARQTESEA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagcggcttttacgaagaactcgcggagatcctggaggtcgagccaaaccaagtgacg gccgacctacgcttggagagcacgtcgtgggactcgctggctgtggtctccaccattgcc ctgatcgatgagcagtatgacaaggcggtcaacgccacggccctcgctgcgtgcgagacg gtcggcgatatcgaacgcttgattgcagcacgccagaccgagagcgaggcgtaa

DBGET integrated database retrieval system