Myxococcus faecalis: VZP55_25810 Help Entry VZP55_25810       CDS       T11143                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mfae  Myxococcus faecalis Pathway mfae00998   Biosynthesis of various antibiotics mfae01100   Metabolic pathways mfae01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mfae00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     VZP55_25810 (acpP)    00074 Mycolic acid biosynthesis     VZP55_25810 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     VZP55_25810 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  XSF01135 LinkDB All DBs Position 6222520..6222762 Genome browser AA seq 80 aa AA seqDB search MSTSAIEAKVKNIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKTVGDAIKYVTDHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacgtccgctattgaggccaaggtcaagaacatcatcgccgaccagctcggcgtg ggagaggacgagatcaagcccgagtcgtccttcatcgaggaccttggcgccgacagcctc gacatcgtcgagctcgtgatggcgatggaagaggagttcgaggtcgagattcccgacgag gaggccgagaacatcaagaccgttggcgacgccatcaagtacgtcaccgaccacaagaag tag

DBGET integrated database retrieval system