Corallococcus macrosporus HW-1: LILAB_31795 Help Entry LILAB_31795       CDS       T01558                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mfu  Corallococcus macrosporus HW-1 Pathway mfu01100   Metabolic pathways mfu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mfu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     LILAB_31795 (acpP)    00074 Mycolic acid biosynthesis     LILAB_31795 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     LILAB_31795 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  AEI68240 UniProt:  F8C8B3 LinkDB All DBs Position complement(7819429..7819671) Genome browser AA seq 80 aa AA seqDB search MSTSTIEAKVKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKCVNDAINYINTHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacgtcaaccattgaggccaaggtcaagtccatcatcgccgaccagcttggggtg ggagaggatgagatcaagccggagtcctccttcatcgaggacctgggcgcggacagcctc gacatcgtggaactcgtgatggcgatggaagaggagttcgaggtcgagatcccggacgaa gaggcggagaacatcaagtgcgtcaacgacgccatcaactacatcaacacccacaagaag tag

DBGET integrated database retrieval system