Meleagris gallopavo (turkey): 100544848 Help Entry 100544848         CDS       T01523                                  Name (RefSeq) histone H2A-IV-like   KO K11251   histone H2A Organism mgp  Meleagris gallopavo (turkey) Pathway mgp03082   ATP-dependent chromatin remodeling mgp04217   Necroptosis Brite KEGG Orthology (KO) [BR:mgp00001]  09120 Genetic Information Processing   09126 Chromosome    03082 ATP-dependent chromatin remodeling     100544848  09140 Cellular Processes   09143 Cell growth and death    04217 Necroptosis     100544848  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:mgp03036]     100544848   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:mgp04147]     100544848 Chromosome and associated proteins [BR:mgp03036]  Eukaryotic type   Nucleosome assembly factors    Histones     100544848 Exosome [BR:mgp04147]  Exosomal proteins   Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)    100544848 SSDB OrthologParalogGFIT Motif Pfam:  Histone_H2A_C Histone Clp_N Motif Other DBs NCBI-GeneID:  100544848 NCBI-ProteinID:  XP_003202265 LinkDB All DBs Position 1:<46352657..46353021 Genome browser AA seq 67 aa AA seqDB search ILELAGNAARDNKKTRIIPRHLQLAIRNDEELNKLLGKVTIAQGGVLPNIQAVLLPKKTD SHKAKAK NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atcctggagctggcgggcaacgcggcccgcgacaacaagaagacgcgcatcatcccccgc cacctgcagctggccatccgcaacgacgaggagctcaacaagctgctgggcaaggtcacc atcgcacagggcggggtgctgcccaacatccaggctgtgctgctgcccaagaagaccgac agccacaaggctaaggccaagtga

DBGET integrated database retrieval system