Micrococcus sp. KBS0714: B1A86_00009505 Help Entry B1A86_00009505    CDS       T06141                                  Name (GenBank) integration host factor   KO K03530   DNA-binding protein HU-beta Organism mick  Micrococcus sp. KBS0714 Brite KEGG Orthology (KO) [BR:mick00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:mick03032]     B1A86_00009505    03036 Chromosome and associated proteins [BR:mick03036]     B1A86_00009505    03400 DNA repair and recombination proteins [BR:mick03400]     B1A86_00009505 DNA replication proteins [BR:mick03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     B1A86_00009505 Chromosome and associated proteins [BR:mick03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     B1A86_00009505 DNA repair and recombination proteins [BR:mick03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       B1A86_00009505 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG SSB DUF2267 Motif Other DBs NCBI-ProteinID:  QDW18087 UniProt:  A0AAJ3PQQ3 LinkDB All DBs Position complement(2076077..2076358) Genome browser AA seq 93 aa AA seqDB search MAMNRKELVAAVAERSGNTQAAVSDVLDALFEVFTAQVKKGEKVSIPGWLAVERTERKER TGRNPRTGEEITIPAGHSVKVTAGSKLKAAASE NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atggccatgaaccgcaaggaactcgtcgccgccgtcgccgagcgctccggcaacacccag gccgccgtcagcgatgtgctggacgccctcttcgaggtgttcaccgcccaggtcaagaag ggcgagaaggtctcgatcccgggctggctggccgtggagcgcaccgagcgcaaggagcgc accggccgcaacccgcgcaccggcgaggagatcaccatcccggccggccactccgtgaag gtgaccgccggctccaagctcaaggccgccgcctccgagtga

DBGET integrated database retrieval system