Mycobacterium paraintracellulare: OCQ_09500 Help Entry OCQ_09500         CDS       T01755                                  Name (GenBank) hypothetical protein   KO K04093   chorismate mutase [EC:5.4.99.5] Organism mir  Mycobacterium paraintracellulare Pathway mir00400   Phenylalanine, tyrosine and tryptophan biosynthesis mir01100   Metabolic pathways mir01110   Biosynthesis of secondary metabolites mir01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:mir00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     OCQ_09500 Enzymes [BR:mir01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      OCQ_09500 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CM_2 Motif Other DBs NCBI-ProteinID:  AFC52463 UniProt:  A0ABM8HMY8 LinkDB All DBs Position complement(940427..940699) Genome browser AA seq 90 aa AA seqDB search MNIETVETQGATDIDDLRLEIDRLDAEILAAVKRRTEVSQAIGKARMASGGTRLVHSREM KVIERYSELGPDGKDLAILLLRLGRGRLGH NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacatcgagacggtggagacccaaggggccaccgacatcgacgacctacgtctcgag atcgatcggctggacgccgagatcctcgccgcggtcaaacggcgcaccgaggtatcacaa gcgatcggcaaggcccggatggcctccggcgggacgcgacttgtccacagccgcgagatg aaggtcatcgagcgctacagcgagctcggccccgacggcaaggacctggcgatactgttg ctgcggctgggcaggggccggctcggtcactga

DBGET integrated database retrieval system