Mitsuaria sp. 7: ABE85_10210 Help Entry ABE85_10210       CDS       T04402                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism miu  Mitsuaria sp. 7 Brite KEGG Orthology (KO) [BR:miu00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:miu03036]     ABE85_10210 Chromosome and associated proteins [BR:miu03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     ABE85_10210 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Crescentin DUF4164 Cep57_CLD_2 YabA DUF1409 DivIVA PAH Motif Other DBs NCBI-ProteinID:  ANH67863 UniProt:  A0A1A9HJN0 LinkDB All DBs Position 2299806..2300060 Genome browser AA seq 84 aa AA seqDB search MSSINDLVDRVERLLVRHEELKRTNGLLEQQVQALTLERDSLRSRLAAARARVDALLDRL PLEAVDLLESSDGTEPSNSRKTGA NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atgtccagcatcaacgacctagtcgaccgcgtcgagcgcctgctggtgcgtcacgaggaa ctcaaacgcacgaacggcttgctcgagcaacaggtccaggcgctcacgctggagcgcgac agcctgcgctccagacttgccgcggcgcgcgcgcgcgtcgatgccctgctggaccgcctg ccgctggaagcggtcgacctgcttgaaagcagcgacggcactgaaccctccaattctcga aagacgggcgcatga

DBGET integrated database retrieval system