Myxococcus landrumensis: JY572_10100 Help Entry JY572_10100       CDS       T09993                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mlan  Myxococcus landrumensis Pathway mlan00998   Biosynthesis of various antibiotics mlan01100   Metabolic pathways mlan01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mlan00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     JY572_10100    00074 Mycolic acid biosynthesis     JY572_10100   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     JY572_10100 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF1493 Motif Other DBs NCBI-ProteinID:  QSQ16367 UniProt:  A0ABX7NC53 LinkDB All DBs Position 2766479..2766736 Genome browser AA seq 85 aa AA seqDB search MTKTELYENLRTLLQDTFDIDPARITPEARLRDDLDIDSIDAVDLLVKLKPVTGKRVPPE VFKSVRTIQDVVDALHGLLEESVAA NT seq 258 nt NT seq  +upstreamnt  +downstreamnt atgaccaagaccgagctctacgaaaacctgcgcacgctcctgcaggacacgttcgacatc gacccggcccgcatcacgcccgaggcgcggctccgcgatgacctggacatcgacagcatc gacgcggtggacctgctcgtgaagctcaagcccgtcacgggcaagcgcgtcccgccggag gtcttcaagtccgtgcgcaccatccaggacgtcgtcgacgccctgcacggcctgctcgaa gaatccgtggcggcgtga

DBGET integrated database retrieval system