Mariniflexile litorale: QLS71_016900 Help Entry QLS71_016900      CDS       T10312                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mlil  Mariniflexile litorale Pathway mlil01100   Metabolic pathways mlil01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mlil00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QLS71_016900    00074 Mycolic acid biosynthesis     QLS71_016900   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QLS71_016900 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Homoserine_dh DUF5495 Motif Other DBs NCBI-ProteinID:  XBL13986 UniProt:  A0AAU7EGI0 LinkDB All DBs Position 4000972..4001211 Genome browser AA seq 79 aa AA seqDB search MDSTILDKIKVIFSNVLEHSDFNLTESTTTKDVNGWESSTHMMIITEVETEFDIEFELDE LWSMKNVGDLVRIIALKTQ NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atggatagtactatactagataaaattaaagttattttctccaatgtattggaacatagc gactttaaccttacagaatctacaactacaaaagatgtgaatggttgggagtcatctaca cacatgatgattattaccgaggtagaaacagaatttgatatagaattcgaattggatgag ttatggagcatgaaaaatgttggtgatttagtacgaattatagccttaaaaacacagtag

DBGET integrated database retrieval system