Corallococcus macrosporus DSM 14697: MYMAC_004667 Help Entry MYMAC_004667      CDS       T05096                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mmas  Corallococcus macrosporus DSM 14697 Pathway mmas01100   Metabolic pathways mmas01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mmas00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MYMAC_004667    00074 Mycolic acid biosynthesis     MYMAC_004667   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MYMAC_004667 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  ATB49030 UniProt:  A0A250JZG1 LinkDB All DBs Position complement(5877878..5878120) Genome browser AA seq 80 aa AA seqDB search MSTSTIEAKVKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKCVNDAINYINTHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacgtcaaccattgaggccaaggtcaagtccatcatcgccgaccagcttggggtg ggagaggatgagatcaagccggagtcctccttcatcgaggacctgggcgcggacagcctc gacatcgtggaactcgtgatggcgatggaagaggagttcgaggtcgagatcccggacgaa gaggcggagaacatcaagtgcgtcaacgacgccatcaactacatcaacacccacaagaag tag

DBGET integrated database retrieval system