KEGG   Mus musculus (house mouse): 723893
Entry
723893            miRNA     T01002                                 
Symbol
Mir10a, Mirn10a, miR-10a, mmu-mir-10a
Name
(RefSeq) microRNA 10a
  KO
K16864  microRNA 10a
Organism
mmu  Mus musculus (house mouse)
Pathway
mmu05205  Proteoglycans in cancer
mmu05206  MicroRNAs in cancer
mmu05418  Fluid shear stress and atherosclerosis
Brite
KEGG Orthology (KO) [BR:mmu00001]
 09160 Human Diseases
  09161 Cancer: overview
   05206 MicroRNAs in cancer
    723893 (Mir10a)
   05205 Proteoglycans in cancer
    723893 (Mir10a)
  09166 Cardiovascular disease
   05418 Fluid shear stress and atherosclerosis
    723893 (Mir10a)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:mmu03100]
    723893 (Mir10a)
Non-coding RNAs [BR:mmu03100]
 Small non-coding RNA
  Micro RNA
   723893 (Mir10a)
SSDB
Other DBs
NCBI-GeneID: 723893
MGI: 3619064
Ensembl: ENSMUSG00000065519
miRBase: MI0000685
LinkDB
Position
11:96207991..96208100
NT seq 23 nt   +upstreamnt  +downstreamnt
taccctgtagatccgaatttgtg

DBGET integrated database retrieval system