Methylobacterium nodulans: Mnod_1634 Help Entry Mnod_1634         CDS       T00839                                  Name (GenBank) phosphopantetheine-binding   KO K02078   acyl carrier protein Organism mno  Methylobacterium nodulans Pathway mno00998   Biosynthesis of various antibiotics mno01100   Metabolic pathways mno01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mno00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mnod_1634    00074 Mycolic acid biosynthesis     Mnod_1634   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mnod_1634 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ACL56624 UniProt:  B8IPX4 LinkDB All DBs Position 1723139..1723411 Genome browser AA seq 90 aa AA seqDB search MQQNAIEATLIRILEEVAGVDRAAISRDRRLREELGVDSLSLVDVAVAAEDALGLALPDE ELERARTVGDVIDFIRRATASAEIVSPRPS NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgcagcagaacgccattgaggcgaccctgatccggatcctcgaggaggttgccggggtc gaccgggcggcgatctctcgggacaggcgcctccgagaggagttgggcgtcgattcgctt tcgctggtcgacgtcgccgttgcggcggaggatgcgctcggtctggcgcttccggacgag gagctggagcgtgcccgaacggtcggggacgtcatcgacttcattcggcgcgcaacggcg tccgccgagatcgtgtcgccgcgcccgtcatag

DBGET integrated database retrieval system