Massilia sp. NR 4-1: ACZ75_13365 Help Entry ACZ75_13365       CDS       T04026                                  Name (GenBank) DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism mnr  Massilia sp. NR 4-1 Brite KEGG Orthology (KO) [BR:mnr00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:mnr03032]     ACZ75_13365    03036 Chromosome and associated proteins [BR:mnr03036]     ACZ75_13365    03400 DNA repair and recombination proteins [BR:mnr03400]     ACZ75_13365 DNA replication proteins [BR:mnr03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     ACZ75_13365 Chromosome and associated proteins [BR:mnr03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     ACZ75_13365 DNA repair and recombination proteins [BR:mnr03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       ACZ75_13365 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 DUF2530 HU-CCDC81_euk_1 HU-DNA_bdg Motif Other DBs NCBI-ProteinID:  AKU22306 UniProt:  A0A0K1JZ99 LinkDB All DBs Position 3301127..3301414 Genome browser AA seq 95 aa AA seqDB search MKKGELIAEFAKRTEMSGAAANDAVNTLIAIVTERLKKGDTVGITGFGTFSVAKRAARKG RNPATGEAIKIAASKTPKFSAGATLKAAVNPTKKK NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atgaaaaaaggcgaactgattgcagaatttgcgaaacgtaccgagatgtccggtgccgcc gccaatgacgcagtgaacactctgattgccatcgttaccgagcgtctgaaaaaaggcgat acggtcggcatcaccggcttcggcaccttctccgtcgccaaacgcgctgctcgcaaaggc cgcaatcctgcaaccggcgaagcgatcaaaatcgccgcgtccaagaccccaaaattctcg gctggcgctaccctgaaagcggcagtgaacccaaccaagaagaagtaa

DBGET integrated database retrieval system