Modestobacter sp. L9-4: KUM42_11785 Help Entry KUM42_11785       CDS       T10178                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism mom  Modestobacter sp. L9-4 Brite KEGG Orthology (KO) [BR:mom00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:mom03032]     KUM42_11785    03036 Chromosome and associated proteins [BR:mom03036]     KUM42_11785    03400 DNA repair and recombination proteins [BR:mom03400]     KUM42_11785 DNA replication proteins [BR:mom03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     KUM42_11785 Chromosome and associated proteins [BR:mom03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     KUM42_11785 DNA repair and recombination proteins [BR:mom03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       KUM42_11785 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG DUF7346 LacI DUF7518 TrmB HU-DNA_bdg Motif Other DBs NCBI-ProteinID:  QXG74574 LinkDB All DBs Position complement(2512968..2513255) Genome browser AA seq 95 aa AA seqDB search MNKAELVSAIAKRADVPTATVDSVINGLQEELVEAITRGDKVALPGLLTVERSQRSARTG RNPQTGESIEIAAAHTAKVTAGSNLKKAAAAVPVK NT seq 288 nt NT seq  +upstreamnt  +downstreamnt atgaacaaggccgaactcgtctctgccatcgccaagcgcgccgacgtccccaccgcgacg gtcgactccgtcatcaacggtctgcaggaggagctggtcgaggccatcacccgcggcgac aaggtcgccctgccgggtctgctgaccgtcgagcgctcgcagcgttcggcccgtaccggc cgcaacccgcagaccggcgagtcgatcgagatcgccgccgcgcacaccgccaaggtgacc gccggctccaacctcaagaaggccgctgccgccgtccccgtcaagtga

DBGET integrated database retrieval system