Methanocella paludicola: MCP_0806 Help Entry MCP_0806          CDS       T01142                                  Symbol rpl40e Name (GenBank) 50S ribosomal protein L40e   KO K02927   ubiquitin-large subunit ribosomal protein L40e Organism mpd  Methanocella paludicola Pathway mpd03010   Ribosome Brite KEGG Orthology (KO) [BR:mpd00001]  09120 Genetic Information Processing   09122 Translation    03010 Ribosome     MCP_0806 (rpl40e)   09123 Folding, sorting and degradation    04120 Ubiquitin mediated proteolysis     MCP_0806 (rpl40e)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03011 Ribosome [BR:mpd03011]     MCP_0806 (rpl40e)    04121 Ubiquitin system [BR:mpd04121]     MCP_0806 (rpl40e) Ribosome [BR:mpd03011]  Ribosomal proteins   Eukaryotes    Large subunit     MCP_0806 (rpl40e)   Archaea     MCP_0806 (rpl40e) Ubiquitin system [BR:mpd04121]  Ubiquitins and ubiquitin-like proteins   Ubiquitins    MCP_0806 (rpl40e) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Ribosomal_L40e Zn_Ribbon_1 DZR DZR_2 Cas12f1-like_TNB zf-ChsH2 Zn_ribbon_RanBP Zn_ribbon_LapB zf-AtTam37 DUF7577 Zn_ribbon_RPAB4 DHHC Motif Other DBs NCBI-ProteinID:  BAI60878 UniProt:  D1YWQ6 LinkDB All DBs Position 793555..793701 Genome browser AA seq 48 aa AA seqDB search MARFPEAEARKLNVQICRKCNARNALRATRCRKCGYTGLRPKKKELKA NT seq 147 nt NT seq  +upstreamnt  +downstreamnt atggcaagatttccagaagccgaggcacggaagcttaacgtacaaatttgcaggaagtgt aatgcgcggaacgcattgcgcgctacccgctgcaggaagtgcgggtataccggcctccgg cccaagaagaaagagctgaaggcgtaa

DBGET integrated database retrieval system