Mycolicibacterium phlei: MPHLCCUG_01840 Help Entry MPHLCCUG_01840    CDS       T04305                                  Symbol mbtL Name (GenBank) Acyl carrier protein MbtL   KO K02078   acyl carrier protein Organism mphl  Mycolicibacterium phlei Pathway mphl01100   Metabolic pathways mphl01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mphl00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MPHLCCUG_01840 (mbtL)    00074 Mycolic acid biosynthesis     MPHLCCUG_01840 (mbtL)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MPHLCCUG_01840 (mbtL) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  AMO60661 LinkDB All DBs Position complement(1901499..1901744) Genome browser AA seq 81 aa AA seqDB search MSVALTEILRDDMNVDVKRVTRDSRLIDDVGLDSVAFAVGMVAIEDKLGIALSEEDLLSC DTVGDLEAAILAKAATAQNQP NT seq 246 nt NT seq  +upstreamnt  +downstreamnt gtgagcgtcgcgctcaccgagatcctgcgcgacgacatgaacgtcgacgtcaagcgagtc acccgcgactcccggctgatcgatgacgtcggtctggactcggtcgcgttcgcggtgggg atggtcgccatcgaggacaagctgggcatcgcgctgagcgaggaggacctgctcagctgc gacaccgtcggcgatctggaggccgccatcctggccaaggcggccacggcgcagaaccag ccgtga

DBGET integrated database retrieval system