Methylorubrum populi: Mpop_3622 Help Entry Mpop_3622         CDS       T00760                                  Name (GenBank) conserved hypothetical protein   KO K02078   acyl carrier protein Organism mpo  Methylorubrum populi Pathway mpo01100   Metabolic pathways mpo01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mpo00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Mpop_3622    00074 Mycolic acid biosynthesis     Mpop_3622   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Mpop_3622 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Motif Other DBs NCBI-ProteinID:  ACB81771 UniProt:  B1Z7G8 LinkDB All DBs Position complement(3868078..3868329) Genome browser AA seq 83 aa AA seqDB search MADVREAIFAFIAARNPGLPSGAVTGETSLVTSDALDSIGILDLMMHLGDRFGVEIDEDS FDLANFDSVDALAHFIDDRRSDA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atggccgacgtgcgggaggcgatcttcgccttcatcgcggcccgcaacccgggccttccc tccggcgccgtcaccggggagacctccctcgtgaccagcgacgcgctggattcgatcggc atcctcgacctgatgatgcatctcggcgaccgcttcggcgtcgagatcgacgaggacagc ttcgacctcgccaatttcgacagcgtcgatgcgctggcccatttcatcgacgaccggcgc tccgacgcctga

DBGET integrated database retrieval system