Marinomonas profundi: J8N69_05310 Help Entry J8N69_05310       CDS       T07858                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mprf  Marinomonas profundi Pathway mprf00998   Biosynthesis of various antibiotics mprf01100   Metabolic pathways mprf01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mprf00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     J8N69_05310    00074 Mycolic acid biosynthesis     J8N69_05310   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     J8N69_05310 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding Baculo_LEF-11 Motif Other DBs NCBI-ProteinID:  UDV04172 LinkDB All DBs Position 1144522..1144773 Genome browser AA seq 83 aa AA seqDB search MKNITRNEIRALIREILEKNNDTNHIGDDDALISSGRLDSLDIAELMIYLQDEYGINTAN SDPDFYNKLDSIESITQYINQHN NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgaaaaatatcacgcgcaatgaaattcgagcgcttatccgtgagatattagaaaaaaac aacgatacaaaccacattggtgacgatgatgcacttatatcatcaggcagactcgactcg ttggacattgccgaattaatgatttatttacaagacgaatatggtatcaatacggctaac tcggaccccgacttttacaataagctggattctatagagtcaattacccagtatattaac cagcataattaa

DBGET integrated database retrieval system