Mycobacterium pseudoshottsii: MPSD_01720 Help Entry MPSD_01720        CDS       T07300                                  Name (GenBank) hypothetical protein   KO K02078   acyl carrier protein Organism mpse  Mycobacterium pseudoshottsii Pathway mpse01100   Metabolic pathways mpse01110   Biosynthesis of secondary metabolites Module mpse_M00885   Meromycolic acid biosynthesis, initiation and elongation FAS II (KasA) mpse_M00886   Meromycolic acid biosynthesis, initiation and elongation FAS II (KasA and KasB) Brite KEGG Orthology (KO) [BR:mpse00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MPSD_01720    00074 Mycolic acid biosynthesis     MPSD_01720   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MPSD_01720 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding DUF5064 Activator-TraM RLL ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  BBA85916 LinkDB All DBs Position 183717..183998 Genome browser AA seq 93 aa AA seqDB search MSEVRVFLVEFIADELEIATTEVRDSSELIRDLGFDSLAFASTVSEIASRFGVRLSKDDV FESKTVGALVELVESRKSAPDAVNAAVNASGNP NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atgtcagaggtgcgtgttttccttgttgagttcatcgctgacgaactcgagatcgccaca actgaggtgcgggactcttccgaactcatcagggacctcgggttcgactcacttgcgttc gcttcgacggtgtcggaaattgccagccggttcggtgtgcgactgagcaaagacgacgtc ttcgaatccaagacggtgggcgcgttggttgagctggtggagagccggaagagcgcgccg gatgcggtgaatgctgccgtcaacgcgtcgggtaacccgtga

DBGET integrated database retrieval system