Mycolicibacterium rufum: MJO55_05700 Help Entry MJO55_05700       CDS       T08167                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mrf  Mycolicibacterium rufum Pathway mrf00998   Biosynthesis of various antibiotics mrf01100   Metabolic pathways mrf01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mrf00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MJO55_05700    00074 Mycolic acid biosynthesis     MJO55_05700   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MJO55_05700 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  ULP37925 LinkDB All DBs Position complement(1820970..1821221) Genome browser AA seq 83 aa AA seqDB search MKTTHEIRDDVLSVLTAIAPEVEADEIRDDALLRDQVDLDSMDWLNFLLGIHKRLDVEIP EADYQRLRTLADVVGYVEAHAGS NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgaagaccacccacgagatccgcgacgatgtgctgtcggtgctgaccgcgatcgccccg gaggtggaggccgacgagatccgcgacgacgcgctgctgcgcgaccaggtggacctggat tcgatggactggctcaatttccttctcggcatccacaaacggctcgacgtcgagatcccc gaggccgactaccagaggttgcggacgctggccgatgtggtcggctacgtggaggcgcac gcaggctcgtga

DBGET integrated database retrieval system