Marinobacterium sediminicola: LN244_02320 Help Entry LN244_02320       CDS       T07998                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism msec  Marinobacterium sediminicola Brite KEGG Orthology (KO) [BR:msec00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:msec03036]     LN244_02320 (zapB) Chromosome and associated proteins [BR:msec03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LN244_02320 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB SAS4 DUF4795 YabA EF-hand_7 Cep57_MT_bd CdaS_N KIF21A APG6_N TSC22 Spc7 Motif Other DBs NCBI-ProteinID:  ULG69676 LinkDB All DBs Position complement(492594..492788) Genome browser AA seq 64 aa AA seqDB search MQSELFTELESKIEGLIEEVELLRLEVSELRQAKQGLEEERSRTEQNLQRLLGKFDRLKE SENI NT seq 195 nt NT seq  +upstreamnt  +downstreamnt atgcagagcgaactctttaccgaactggaaagcaaaattgagggattgatcgaagaggtc gaactgctgcgcttggaagtcagtgagctgcgccaggccaaacaaggcctcgaagaggaa cgttcccggaccgaacaaaacctgcagcgtctgctgggcaagtttgatcgcctgaaggaa agcgaaaacatctga

DBGET integrated database retrieval system