Myxococcus xanthus: MXAN_4769 Help Entry MXAN_4769         CDS       T00366                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism mxa  Myxococcus xanthus Pathway mxa01100   Metabolic pathways mxa01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:mxa00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     MXAN_4769 (acpP)    00074 Mycolic acid biosynthesis     MXAN_4769 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     MXAN_4769 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L12_N DUF1493 Motif Other DBs NCBI-ProteinID:  ABF90332 UniProt:  Q1D342 LinkDB All DBs Position complement(5969951..5970193) Genome browser AA seq 80 aa AA seqDB search MSTSTIEAKVKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKTVNDAVSYINTHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacgtcaaccattgaggccaaggtcaagtccatcatcgccgaccagctcggtgtc ggagaggatgagatcaagccggagtcctccttcatcgaggacctcggcgcggacagcctc gacatcgtggagctcgtcatggcgatggaagaggagttcgaggtcgagattcccgacgaa gaggcggagaacatcaagaccgtcaacgacgccgtcagctacatcaacacccacaagaag tag

DBGET integrated database retrieval system