Myxococcus sp. MxC21-1: QEG98_25750 Help Entry QEG98_25750       CDS       T09754                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism myx  Myxococcus sp. MxC21-1 Pathway myx01100   Metabolic pathways myx01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:myx00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     QEG98_25750 (acpP)    00074 Mycolic acid biosynthesis     QEG98_25750 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     QEG98_25750 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C DUF1493 Motif Other DBs NCBI-ProteinID:  WNZ59455 LinkDB All DBs Position complement(5769077..5769319) Genome browser AA seq 80 aa AA seqDB search MSTSTIEAKVKSIIADQLGVGEDEIKPESSFIEDLGADSLDIVELVMAMEEEFEVEIPDE EAENIKTVADATNYINTHKK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcgacgtcaaccattgaggccaaggtcaagtccatcatcgccgaccagctcggtgtc ggagaggatgagatcaagccggagtcctccttcatcgaggacctgggcgcggacagcctc gacatcgtggagctcgtcatggcgatggaagaggagttcgaggtcgagattcccgacgaa gaggcggagaacatcaagaccgtcgccgacgccaccaactacatcaacacccacaagaag tag

DBGET integrated database retrieval system